Review



pgl3basic plasmid  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Promega pgl3basic plasmid
    Pgl3basic Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pgl3+basic/pm40310867-64-15-17
    Average 90 stars, based on 1 article reviews
    pgl3basic plasmid - by Bioz Stars, 2026-10
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer.
    Article Snippet: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer K Fukuda, M Abei, H Ugai, R Kawashima, E Seo, M Wakayama, T Murata, S Endo, H Hamada, I Hyodo and KK Yokoyama Division of Gastroenterology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan; Division of Gene Engineering, BioResource Center, Institute of Physical and Chemical Research, RIKEN, Tsukuba, Ibaraki, Japan and Department of Molecular Medicine, Sapporo Medical University, Sapporo, Hokkaido, Japan

    Article Title: A novel hypoxia-response element in the lactate dehydrogenase-B gene of the killifish Fundulus heteroclitus.
    Article Snippet: a Department of Biological Sciences, University of New Orleans, New Orleans, LA, 70148, USA b Department of Pharmacology, Tulane University Health Sciences Center, New Orleans, LA, 70112, USA c College of Pharmacy, Xavier University of Louisiana, New Orleans, LA, 70125, USA d Tulane/Xavier Center for Bioenvironmental Research, New Orleans, LA, 70112, USA e Department of Zoology, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

    Article Title: Modulation of IFN-γ receptor 1 expression by AP-2α influences IFN-γ sensitivity of cancer cells.
    Article Snippet: Interferon (IFN)plays crucial roles in regulating both innate and adaptive immunity.. The existence of IFNreceptor 1 (IFNGR1) molecules on the cell surface is a prerequisite to the initiation of IFNsignaling; low expression of IFNGR1 leads to a functional blockade of IFNsignaling.. However, the molecular mechanisms by which IFNGR1 expression is controlled are unclear.

    Article Title: Development of Robust Varicella Zoster Virus Luciferase Reporter Viruses for In Vivo Monitoring of Virus Growth and Its Antiviral Inhibition in Culture, Skin, and Humanized Mice
    Article Snippet: .. For this purpose, a plasmid construct was developed in which the ORF for the firefly luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) by using the primers, fLucF and fLucR (all primer sequences are presented in ). .. The resulting DNA fragment was digested with EcoRI and BamHI (sites underlined) and was cloned into the vector, pmCherryC1 (Clontech Inc., San Jose, CA, USA), and was cut with EcoRI and BglII in order to place it in-frame with pmCherry.

    Article Title: RNA-seq Analysis of Host and Viral Gene Expression Highlights Interaction between Varicella Zoster Virus and Keratinocyte Differentiation
    Article Snippet: .. Luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) using the primers 5′ GAG GGATCC GGTTCCGGAGAGGGCAGAGGA AGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGAAGACGCC AAAAACATA-3′ and 5′ AATTC GAATTC GCGCGC AGATCT TTACACGGCGATCTTTCCGCCCTTCTTGGC-3′ . ..

    Virus:

    Article Title: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer.
    Article Snippet: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer K Fukuda, M Abei, H Ugai, R Kawashima, E Seo, M Wakayama, T Murata, S Endo, H Hamada, I Hyodo and KK Yokoyama Division of Gastroenterology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan; Division of Gene Engineering, BioResource Center, Institute of Physical and Chemical Research, RIKEN, Tsukuba, Ibaraki, Japan and Department of Molecular Medicine, Sapporo Medical University, Sapporo, Hokkaido, Japan

    Luciferase:

    Article Title: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer.
    Article Snippet: E1A, E1B double-restricted replicative adenovirus at low dose greatly augments tumor-specific suicide gene therapy for gallbladder cancer K Fukuda, M Abei, H Ugai, R Kawashima, E Seo, M Wakayama, T Murata, S Endo, H Hamada, I Hyodo and KK Yokoyama Division of Gastroenterology, Graduate School of Comprehensive Human Sciences, University of Tsukuba, Tsukuba, Ibaraki, Japan; Division of Gene Engineering, BioResource Center, Institute of Physical and Chemical Research, RIKEN, Tsukuba, Ibaraki, Japan and Department of Molecular Medicine, Sapporo Medical University, Sapporo, Hokkaido, Japan

    Article Title: Development of Robust Varicella Zoster Virus Luciferase Reporter Viruses for In Vivo Monitoring of Virus Growth and Its Antiviral Inhibition in Culture, Skin, and Humanized Mice
    Article Snippet: .. For this purpose, a plasmid construct was developed in which the ORF for the firefly luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) by using the primers, fLucF and fLucR (all primer sequences are presented in ). .. The resulting DNA fragment was digested with EcoRI and BamHI (sites underlined) and was cloned into the vector, pmCherryC1 (Clontech Inc., San Jose, CA, USA), and was cut with EcoRI and BglII in order to place it in-frame with pmCherry.

    Article Title: RNA-seq Analysis of Host and Viral Gene Expression Highlights Interaction between Varicella Zoster Virus and Keratinocyte Differentiation
    Article Snippet: .. Luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) using the primers 5′ GAG GGATCC GGTTCCGGAGAGGGCAGAGGA AGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGAAGACGCC AAAAACATA-3′ and 5′ AATTC GAATTC GCGCGC AGATCT TTACACGGCGATCTTTCCGCCCTTCTTGGC-3′ . ..

    other:

    Article Title: Measuring transcription factor function with cell type-specific somatic transgenesis in chicken embryos.
    Article Snippet: The luciferase reporter plasmids were made by subcloning the combined Col2a1 regulatory elements described above, without or with the same Ad5 splice acceptor sequence from pSlax as HindIII–NcoI fragments into pGL3Basic (Promega) to make pGL3-Col2a1-luc and pGL3-Col2a1-SA-luc respectively.

    Article Title: Cardiomyocyte transcription is controlled by combined mineralocorticoid receptor and circadian clock signalling
    Article Snippet: The following plasmids were used: pGL3basic (Promega), pGL3-enhancer (Promega), PRshMR (a gift from Prof. R Evans), CNK3 (Ziera et al. 2009), pcDNA3.1(+), pcDNA4.0, pBMP3C, pCKPC4, MMTV.luc and Per1.luc (Fletcher et al. 2017).

    Article Title: SP PROTEINS AND RUNX2 MEDIATE REGULATION OF MATRIX GLA PROTEIN (MGP) EXPRESSION BY PARATHYROID HORMONE
    Article Snippet: This plasmid contains bases -748 to +1 of the murine Mgp gene inserted into the HindIII site of pGL3Basic (Promega) upstream of the firefly luciferase reporter gene.

    Polymerase Chain Reaction:

    Article Title: A novel hypoxia-response element in the lactate dehydrogenase-B gene of the killifish Fundulus heteroclitus.
    Article Snippet: a Department of Biological Sciences, University of New Orleans, New Orleans, LA, 70148, USA b Department of Pharmacology, Tulane University Health Sciences Center, New Orleans, LA, 70112, USA c College of Pharmacy, Xavier University of Louisiana, New Orleans, LA, 70125, USA d Tulane/Xavier Center for Bioenvironmental Research, New Orleans, LA, 70112, USA e Department of Zoology, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

    Article Title: Modulation of IFN-γ receptor 1 expression by AP-2α influences IFN-γ sensitivity of cancer cells.
    Article Snippet: Interferon (IFN)plays crucial roles in regulating both innate and adaptive immunity.. The existence of IFNreceptor 1 (IFNGR1) molecules on the cell surface is a prerequisite to the initiation of IFNsignaling; low expression of IFNGR1 leads to a functional blockade of IFNsignaling.. However, the molecular mechanisms by which IFNGR1 expression is controlled are unclear.

    Article Title: Development of Robust Varicella Zoster Virus Luciferase Reporter Viruses for In Vivo Monitoring of Virus Growth and Its Antiviral Inhibition in Culture, Skin, and Humanized Mice
    Article Snippet: .. For this purpose, a plasmid construct was developed in which the ORF for the firefly luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) by using the primers, fLucF and fLucR (all primer sequences are presented in ). .. The resulting DNA fragment was digested with EcoRI and BamHI (sites underlined) and was cloned into the vector, pmCherryC1 (Clontech Inc., San Jose, CA, USA), and was cut with EcoRI and BglII in order to place it in-frame with pmCherry.

    Article Title: RNA-seq Analysis of Host and Viral Gene Expression Highlights Interaction between Varicella Zoster Virus and Keratinocyte Differentiation
    Article Snippet: .. Luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) using the primers 5′ GAG GGATCC GGTTCCGGAGAGGGCAGAGGA AGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGAAGACGCC AAAAACATA-3′ and 5′ AATTC GAATTC GCGCGC AGATCT TTACACGGCGATCTTTCCGCCCTTCTTGGC-3′ . ..

    Purification:

    Article Title: A novel hypoxia-response element in the lactate dehydrogenase-B gene of the killifish Fundulus heteroclitus.
    Article Snippet: a Department of Biological Sciences, University of New Orleans, New Orleans, LA, 70148, USA b Department of Pharmacology, Tulane University Health Sciences Center, New Orleans, LA, 70112, USA c College of Pharmacy, Xavier University of Louisiana, New Orleans, LA, 70125, USA d Tulane/Xavier Center for Bioenvironmental Research, New Orleans, LA, 70112, USA e Department of Zoology, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

    Clone Assay:

    Article Title: A novel hypoxia-response element in the lactate dehydrogenase-B gene of the killifish Fundulus heteroclitus.
    Article Snippet: a Department of Biological Sciences, University of New Orleans, New Orleans, LA, 70148, USA b Department of Pharmacology, Tulane University Health Sciences Center, New Orleans, LA, 70112, USA c College of Pharmacy, Xavier University of Louisiana, New Orleans, LA, 70125, USA d Tulane/Xavier Center for Bioenvironmental Research, New Orleans, LA, 70112, USA e Department of Zoology, University of British Columbia, Vancouver, BC, Canada V6T 1Z4

    Amplification:

    Article Title: Modulation of IFN-γ receptor 1 expression by AP-2α influences IFN-γ sensitivity of cancer cells.
    Article Snippet: Interferon (IFN)plays crucial roles in regulating both innate and adaptive immunity.. The existence of IFNreceptor 1 (IFNGR1) molecules on the cell surface is a prerequisite to the initiation of IFNsignaling; low expression of IFNGR1 leads to a functional blockade of IFNsignaling.. However, the molecular mechanisms by which IFNGR1 expression is controlled are unclear.

    Article Title: Development of Robust Varicella Zoster Virus Luciferase Reporter Viruses for In Vivo Monitoring of Virus Growth and Its Antiviral Inhibition in Culture, Skin, and Humanized Mice
    Article Snippet: .. For this purpose, a plasmid construct was developed in which the ORF for the firefly luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) by using the primers, fLucF and fLucR (all primer sequences are presented in ). .. The resulting DNA fragment was digested with EcoRI and BamHI (sites underlined) and was cloned into the vector, pmCherryC1 (Clontech Inc., San Jose, CA, USA), and was cut with EcoRI and BglII in order to place it in-frame with pmCherry.

    Article Title: RNA-seq Analysis of Host and Viral Gene Expression Highlights Interaction between Varicella Zoster Virus and Keratinocyte Differentiation
    Article Snippet: .. Luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) using the primers 5′ GAG GGATCC GGTTCCGGAGAGGGCAGAGGA AGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAATGGAAGACGCC AAAAACATA-3′ and 5′ AATTC GAATTC GCGCGC AGATCT TTACACGGCGATCTTTCCGCCCTTCTTGGC-3′ . ..

    Construct:

    Article Title: Development of Robust Varicella Zoster Virus Luciferase Reporter Viruses for In Vivo Monitoring of Virus Growth and Its Antiviral Inhibition in Culture, Skin, and Humanized Mice
    Article Snippet: .. For this purpose, a plasmid construct was developed in which the ORF for the firefly luciferase was amplified by PCR from the plasmid pGL3basic (Promega Corp) by using the primers, fLucF and fLucR (all primer sequences are presented in ). .. The resulting DNA fragment was digested with EcoRI and BamHI (sites underlined) and was cloned into the vector, pmCherryC1 (Clontech Inc., San Jose, CA, USA), and was cut with EcoRI and BglII in order to place it in-frame with pmCherry.



    Similar Products

    invitrogen pa5  (Addgene inc)
    92
    Addgene inc invitrogen pa5
    Invitrogen Pa5, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pGL3Basic-miR126-EGFL7-Promoter+(Plasmid+%2332244)/pm41916301-334-22-51
    Average 92 stars, based on 1 article reviews
    invitrogen pa5 - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    pgl3basic  (Addgene inc)
    94
    Addgene inc pgl3basic
    Pgl3basic, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/LSB-hsa-miR-299-5p+(Plasmid+%23103390)/10__3390_slash_biotech15010023-47-12-23
    Average 94 stars, based on 1 article reviews
    pgl3basic - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    renilla luciferase reporter vectors  (Addgene inc)
    93
    Addgene inc renilla luciferase reporter vectors
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Renilla Luciferase Reporter Vectors, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pGL3basic+luciferase+and+renilla_polyA+(Plasmid+%23128046)/pmc12559722-356-13-17
    Average 93 stars, based on 1 article reviews
    renilla luciferase reporter vectors - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    pgl3 mdm2 luc  (Addgene inc)
    93
    Addgene inc pgl3 mdm2 luc
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3 Mdm2 Luc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pGL3Basic-Mdm2-T3+(Plasmid+%2332369)/pmc12279375-204-8-10
    Average 93 stars, based on 1 article reviews
    pgl3 mdm2 luc - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    pgl3basic 8x grna egfp  (Addgene inc)
    93
    Addgene inc pgl3basic 8x grna egfp
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic 8x Grna Egfp, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pGL3-Basic-8x-gRNA-eGFP+(Plasmid+%2360718)/pm40598087-191-4-12
    Average 93 stars, based on 1 article reviews
    pgl3basic 8x grna egfp - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    pgl3basic plasmid  (Promega)
    90
    Promega pgl3basic plasmid
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Plasmid, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/pgl3+basic/pm40310867-64-15-17
    Average 90 stars, based on 1 article reviews
    pgl3basic plasmid - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    pgl3basic luciferase reporter plasmid  (ATCC)
    99
    ATCC pgl3basic luciferase reporter plasmid
    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j <t>Luciferase</t> reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to <t>Renilla</t> luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –
    Pgl3basic Luciferase Reporter Plasmid, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plasmid+pgl3basic/Plasmid/pm39828047-113-9-28
    Average 99 stars, based on 1 article reviews
    pgl3basic luciferase reporter plasmid - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –

    Journal: Signal Transduction and Targeted Therapy

    Article Title: Piezo1 activation suppresses bone marrow adipogenesis to prevent osteoporosis by inhibiting a mechanoinflammatory autocrine loop

    doi: 10.1038/s41392-025-02455-w

    Figure Lengend Snippet: Piezo1 suppresses Lcn2 expression and secretion via the inhibition of Ccl2-evoked NF-κB activation. BMMSCs were isolated from femurs and tibias of 10-week-old male PDGFRα-Piezo1 KO mice and WT controls. a Gene expression of Ccr2 in BMMSCs, as determined by real-time PCR. b–g Recombinant mouse Ccl2 protein (rmCcl2, 100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) was added to the adipogenic and osteogenic induction medium during BMMSC differentiation. The expression levels of osteogenic genes ( b–d ) and adipogenic genes ( e–g ) were determined via real-time qPCR. h–n WT and KO BMMSCs were treated with rmCcl2 (100 ng/mL) or the CCR2 antagonist INCB3344 (10 nM) for 24 h. h Sonicated BMMSCs were subjected to chromatin immunoprecipitation (ChIP) using an anti-p65 antibody. The ChIP DNA samples were then subjected to qPCR amplification using specific primers against the promoter region of Lcn2, as shown in supplementary Fig. . Representative gel images of end-point ChIP-qPCR products are shown. i Quantitative results are shown as the percentage of input DNA: % of Input = 2^(CT Input −CT IP )/dilution factor × 100%. j Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Lcn2 promoter (Lcn2-WT) or the mutated Lcn2 promoter with mutations in the NF-κB binding motif (Lcn2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. k Schematic diagram illustrating the actions of rmCcl2, the CCR2 antagonist, and the NF-κB-specific inhibitor QNZ on NF-κB translocation and Lcn2 expression; created with BioRender ( https://BioRender.com ). l ELISA analysis of total p65 in the nucleus and cytoplasm of BMMSCs. m Representative immunofluorescence images of intracellular p65 localization. Nuclei were stained with DAPI (blue). Scale bar, 50 μm. n P65 nuclear translocation was quantified by ImageJ software via Pearson’s correlation coefficient (PCC) between the p65 immunofluorescence signal and DAPI staining across segmented nuclear regions. o , p WT and KO BMMSCs were treated with the NF-κB-specific inhibitor QNZ (10 nM) for another 2 h after 24-h treatment of rmCcl2 (100 ng/mL) and INCB3344 (10 nM). o The mRNA level of Lcn2 . p Lcn2 levels in the culture medium were determined by ELISA. q Illustration of how the AP-1 inhibitor modulates Ccl2 gene expression; created with BioRender ( https://BioRender.com ). r–u WT and KO BMMSCs were treated with the AP-1-specific inhibitor T-5224 (10 μM) for 24 h. r Sonicated BMMSCs were subjected to ChIP assay using an anti-c-Jun antibody. Representative gel images of end-point ChIP-qPCR products are shown. s Quantitative results are shown as the percentage of input DNA. t The mRNA level of Ccl2 . u Ccl2 levels in the culture medium were determined by ELISA. v Luciferase reporter assay was performed in isolated WT and KO BMMSCs transfected with pGL3 constructs containing the mouse wild-type Ccl2 promoter (Ccl2-WT) or the mutated Ccl2 promoter with mutations in the c-Jun binding motif (Ccl2-Mut, sequence in supplementary Fig. ). The firefly luciferase activity was measured and normalized to Renilla luciferase activity. n = 5 for each group. The data are presented as the means ± SEMs; * p < 0.05, ** p < 0.01, *** p < 0.001. See also supplementary Figs. –

    Article Snippet: The luciferase reporter assay was performed by transfecting 0.2 μg of firefly and Renilla luciferase reporter vectors (Addgene, #128046) driven by either the wild-type mouse Lcn2 or Ccl2 promoter (−1999/+1) or their respective mutants (in which the NF-κB or c-Jun DNA binding site was mutated) (Azenta) into BMMSCs seeded in 96-well plates using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, #L3000001).

    Techniques: Expressing, Inhibition, Activation Assay, Isolation, Gene Expression, Real-time Polymerase Chain Reaction, Recombinant, Sonication, Chromatin Immunoprecipitation, Amplification, ChIP-qPCR, Luciferase, Reporter Assay, Transfection, Construct, Binding Assay, Sequencing, Activity Assay, Translocation Assay, Enzyme-linked Immunosorbent Assay, Immunofluorescence, Staining, Software